Editing VvDXS1 for the creation of muscat flavour in Vitis vinifera cv. Scarlet Royal
Yingzhen Yang, Matthew Wheatley, Victoria Meakem, Erin Galarneau, Benjamin Gutierrez, Gan-Yuan Zhong
First published: 20 January 2024; https://doi.org/10.1111/pbi.14290
Summary
Muscat flavour represents a group of unique aromatic attributes in some grape varieties. Biochemically, grape berries with muscat flavour produce high levels of monoterpenes. Monoterpene biosynthesis is mainly through the DOXP/MEP pathway, and VvDXS1 encodes the first enzyme in this plastidial pathway of terpene biosynthesis in grapevine. A single-point mutation resulting in the substitution of a lysine with an asparagine at position 284 in the VvDXS1 protein has previously been identified as the major cause for producing muscat flavour in grapes. In this study, the same substitution in the VvDXS1 protein was successfully created through prime editing in the table grape Vitis vinifera cv. ‘Scarlet Royal’. The targeted point mutation was detected in most of the transgenic vines, with varying editing efficiencies. No unintended mutations were detected in the edited alleles, either by PCR Sanger sequencing or by amplicon sequencing. More than a dozen edited vines were identified with an editing efficiency of more than 50%, indicating that these vines were likely derived from single cells in which one allele was edited. These vines had much higher levels of monoterpenes in their leaves than the control, similar to what was found in leaf samples between field-grown muscat and non-muscat grapes.
.png)
Figure 1: Schematic representation of VvDXS1, PE guide RNAs (pegRNA), and PE constructs. (a) Schematic illustration of the VvDXS1 gene. VvDXS1 contains 10 exons (E1 to E10). Lys284 is at the junction between exon 5 and intron 5. The primer pair 1529/1530 was used for genomic PCR and genotyping of transgenic plants; the primer pair 1582/1515 was used for amplicon sequencing to estimate PE efficiency; the primer pair 1706/1705 was used for amplifying the cDNA region at the target site; and the primer pair 1686/1694 was used for VvDXS1 full-length cDNA amplification. (b) Genomic sequence flanking Lys284 includes part of exon 5 and part of intron 5. The intended gene editing is to change “G” in AAG (red box) to “C” in AAC (purple box) so that the amino acid Lys284 is converted to Asn284 for mimicking the natural muscat VvDXS1m allele for most muscat-flavoured cultivars regarding the amino acid change. An AclI restriction enzyme site (AACgtt) is introduced as a result of the editing. The spacer sequences were marked by coloured texts and arrows and the primer binding sequences (PBS) for the paired pegRNAs were marked by black boxes. (c) Simplified sequence representations of epegRNA1 and epegRNA2. RT: reverse transcript template. TevopreQ1 is the RNA stabilizing motif (“CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA”) added to the end of pegRNA to form epegRNA (Nelson et al., 2022). (d) A schematic illustration of the VvDXS1 PE constructs PD1 and PD2. T-DNA is 13.9 kb for PD1 and 15.4 kb for PD2 between the left border (blue strip) and the right border (black strip). Both constructs had the e35S:Hpt marker for plant selection and VvU6.2:paired-epegRNAs cassette (two enhanced PE guiding RNAs spaced by tRNA as a single polycistronic gene driven by the grape U6.2 promoter. PEMax (a modified prime editor) was used in both PD1 and PD2. However, PEMax was under a 35S promoter in PD1 and under a VvUbi2 promoter in PD2. Furthermore, a 35S:eGFP cassette was included in PD1 for visual tracking of the transformation process. In PD2, a 35S:VvMLHdn cassette was inserted in a similar position instead to enhance PE efficiency.
Views: 249


